Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3 ... 247, 248, 249 ... 254, 255, 256  Page suivante

Triphénylamine

 

Triphénylamine 98 %
Triphenylamine
Référence : 3814436

25 g

186.36 €HT

 

Triphénylamine 99 %+
Triphenylamine
Référence : 7793037

100 g

258.69 €HT

 

Triphénylamine 99 %+
Triphenylamine
Référence : 6192173

25 g

93.79 €HT

 

Triphénylantimoine (III) 99 %

 

 

Triphénylantimoine (III) 99 %
Antimony(III)triphenyl, Triphenylstibine
Référence : 3300820

100 g

111.24 €HT

 

Triphénylantimoine (III) 99 %
Antimony(III)triphenyl, Triphenylstibine
Référence : 6535561

25 g

79.45 €HT

 

Tris(1,3-dichloro-2-propyl)phosphate - Standard analytique

Grade : analytical standard.

Synonym : 1,3-Dichloro-2-propanol phosphate, Phosphoric acid tris(1,3-dichloro-2-propyl ester), Tris(1,3-dichloro-2-propyl) phosphate.
Classe danger : 9 / UN3082 - Groupe d'emballage : III.

Tris(1,3-dichloro-2-propyl)phosphate - Standard analytique
TDCPP ; 1,3-Dichloro-2-propanol phosphate, analytical standard.
Référence : 9099199

100 mg

194.89 €HT

 

X-100

Source biologique : synthetic (organic)
Niveau de qualité : 200
Qualité : Molecular Biology
Description : non-ionic
Forme : liquid
Poids mol.: micellar avg mol wt 80,000 ; average mol wt 625
Nombre d'agrégation : 100-155

Impuretés :
 - DNases, none detected
 - RNases, none detected
 - ...

Triton™ X-100 - BioUltra - Molecular Biology (~10% in H2O)
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 4808028

100 ml

211.18 €HT

 

Triton™ X-100 - BioUltra - Molecular Biology (~10% in H2O)
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 1537791

500 ml

738.09 €HT

 

Triton® X-100 - BioXtra (Polyethylene glycol tert-octylphenyl ether)
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol...
Référence : 9795013

1 litre

715.09 €HT

 

Triton® X-100 - BioXtra (Polyethylene glycol tert-octylphenyl ether)
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol...
Référence : 5541722

100 ml

265.55 €HT

 

Triton® X-100 - BioXtra (Polyethylene glycol tert-octylphenyl ether)
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol...
Référence : 2730737

500 ml

466.27 €HT

 

Triton® X-100 pour laboratoire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 8764099

1 litre

250.91 €HT

 

Triton® X-100 pour laboratoire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 2523988

100 ml

148.66 €HT

 

Triton® X-100 pour laboratoire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 6141717

5 ml

81.75 €HT

 

Triton® X-100 pour laboratoire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 9692939

500 ml

182.54 €HT

 

Triton® X-100, pour biologie moléculaire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 5161297

100 ml

112.28 €HT

 

Triton® X-100, pour biologie moléculaire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 4660443

250 ml

242.55 €HT

 

Triton® X-100, pour biologie moléculaire
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol t-Octylphenoxypolyethoxyethanol
Référence : 1667306

50 ml

71.72 €HT

 

Trityl Losartan / Losartan Impureté H SCR

Synonyme(s) : Losartan N2-Trityl Impurity; N2-Trityl Losartan. 2-Butyl-4-chloro-1-[[2′-[2-(triphenylmethyl)-2H-tetrazol-5-yl][1, 1′-biphenyl-4-yl]methyl]-1H-imidazole-5-methanol.

Trityl Losartan / Losartan Impureté H SCR
N2-Trityl Losartan / Losartan EP Impurity H CRS.
Référence : 4900765

100 mg

 

%+

Total impurities : ≤ 0,2 % water (Karl Fischer)
Useful pH range : 7 - 9
pKa (25°C) = 8.1
bp = 219-220°C/10 mmHg (lit.)
mp = 167-172°C (lit.) ; 168-172°C

tris hydroxymethyl aminoethane ACS 99,8 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 8681566

100 g

39.61 €HT

 

tris hydroxymethyl aminoethane ACS 99,8 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 2211409

500 g

116.45 €HT

 

Tris(hydroxymethyl)aminomethane 99 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 9257963

1 kg

120.53 €HT

 

Tris(hydroxymethyl)aminomethane 99 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 5405355

250 g

42.68 €HT

 

Tris(hydroxymethyl)aminomethane 99 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 3486806

3 kg

319.45 €HT

 

Tris(hydroxymethyl)aminomethane ACS 99,8 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 9077359

100 g

36.75 €HT

 

Tris(hydroxymethyl)aminomethane ACS 99,8 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 1952590

500 g

107.86 €HT

 

Trizma® Base 99,0 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 1284997

1 kg

273.64 €HT

 

Trizma® Base 99,0 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 9936073

100 g

51.86 €HT

 

Trizma® Base 99,0 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 3983573

500 g

163.86 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 8298267

1 kg

1161.68 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 1621203

10 kg

6898.89 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 2384013

100 g

103.92 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 6602546

25 g

56.33 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 3148675

250 g

183.79 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 9919831

5 kg

1971.73 €HT

 

Trizma® Base 99,9 %+ (standard et tampon primaires)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 1174302

500 g

363.82 €HT

 

Trizma® Base P.A. (substance étalon) 99,5 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 5588366

1 kg

308.64 €HT

 

Trizma® Base P.A. (substance étalon) 99,5 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 8974684

100 g

53.77 €HT

 

Trizma® Base P.A. (substance étalon) 99,5 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 5186040

500 g

143.02 €HT

 

Trizma® Base - BioUltra 99,8 %+ (pour biologie moléculaire)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 5296197

1 kg

533.18 €HT

 

Trizma® Base - BioUltra 99,8 %+ (pour biologie moléculaire)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 8538310

250 g

169.15 €HT

 

Trizma® Base - BioUltra 99,8 %+ (pour biologie moléculaire)
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 2566326

500 g

299.00 €HT

 

Trizma® Base - BioXtra, pH 10,5-12,0 (1 M in H2O) 99,9 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 6503593

1 kg

342.05 €HT

 

Trizma® Base - BioXtra, pH 10,5-12,0 (1 M in H2O) 99,9 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 5163286

100 g

59.18 €HT

 

Trizma® Base - BioXtra, pH 10,5-12,0 (1 M in H2O) 99,9 %+
2-Amino-2-(hydroxymethyl)-1,3-propanediol, THAM, Tris base, Trometamol
Référence : 4839625

500 g

198.07 €HT

 

Trométhamine (cristalline) - USP 99-101 %
Tromethamine meets USP testing specifications.
Référence : 5824336

1 kg

397.73 €HT

 

Trométhamine (cristalline) - USP 99-101 %
Tromethamine meets USP testing specifications.
Référence : 3325400

100 g

139.84 €HT

 

Trométhamine - 99,0 %+
Tris(hydroxymethyl)aminomethane.
Référence : 7400205

25 g

41.41 €HT

 

Trométhamine - 99,0 %+
Tris(hydroxymethyl)aminomethane.
Référence : 7008351

500 g

106.11 €HT

 

Trizma® hydrochloride 99,0 %+ for molecular biology Biotechnology Performance Certified

Propriétés
grade Biotechnology Performance Certified
  for molecular biology
assay ≥99.0% (titration)
total impurities DNase, RNase, protease, none detected
  endotoxin and bioburden, tested
  ≤0.5% water (Karl Fischer)
useful pH range 7.0 - 9.0
pKa (25 °C) 8.1
EQP level Elite
mp 150-152 °C
solubility H2O: soluble667 mg/mL
cation traces heavy metals (as Pb): ≤5 ppm
abs. A40%/290 ≤0.05
suitability cell culture tested

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
Référence : 1745395

1 kg

431.14 €HT

 

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
Référence : 4024195

100 g

69.68 €HT

 

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
Référence : 8584050

500 g

286.36 €HT

 

Trompe à eau anti-retour, en verre borosilicaté 3.3 MBL™ - Vide modéré jusquà 65 mbar

Dim°.: Ø.corps x H.tot : 20 x 240 mm. P°. eau : 1 bar. Cons°. eau : 17 l/h.

Référence : 7408476

Unité de vente : Pièce

Trypsine (inhibiteur) à base d'oeuf de poule / Trypsin inhibitor from chicken egg white

Description :
Analysis Note : One mg will inhibit 0.8-1.2 mg of tryspin with activity of approx. 10,000 BAEE units per mg protein. May inhibit ≤0.3 mg of chymotrypsin with activity of approx. 40 BTEE units per mg protein.
Other Note : Ovomucoid, from chicken egg white, does not itself inhibit chymotrypsin. Chymotrypsin inhibition is a measure of ovoinhibitor contamination by method of Feeney, R. E., et al., J. Biol. Chem., 238, 1415 (1963).
Unit Definition : One trypsin unit will produce a ΔA253 of 0.001 per min with BAEE as substrate at pH 7.6 at 25 °C; reaction volume 3.2 mL, 1 cm light path.

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 2081570

1 g

307.67 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 5871056

250 mg

99.53 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 8322501

5 g

1198.30 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 9822482

500 mg

186.98 €HT

 

CAS 9002-07-7

Températrue de stockage : -20 °C.

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 5161989

1 g

176.18 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 4866157

10 g

1321.36 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 6810377

100 mg

59.76 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 6321883

5 g

738.41 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
Référence : 4733694

500 mg

84.46 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
Référence : 5335559

10 g

51.19 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
Référence : 8155281

100 g

249.20 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
Référence : 9924873

25 g

94.08 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
Référence : 3813182

5 g

28.01 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
Référence : 4240242

500 g

1149.43 €HT

 

Trypsine-EDTA solution 10x
0.5% trypsin, 0.2% EDTA, trypsin gamma irrdiated by SER-TAIN Process, without phenol red,
Référence : 6041031

100 ml

35.25 €HT

 

Tryptic Soy (CASO) broth irradiated (sterile) - Merck®

Casein-peptone soymeal-peptone broth USP for microbiology.

Référence : 8882965

Unité de vente : 500 g

Tryptic Soy Agar (TSA)/Trypticase Soja gélose, selon EP, USP, JP, ISO, FDA-BAM GranuCult™

Casein-peptone soyameal-peptone agar, Cacein-peptone soyameal-peptone agar. Merck®.

Référence : 2864224

Unité de vente : 500 g

Tryptic Soy Broth irradiated (sterile) for microbiology - Merck®

Tryptic Soy Broth (TSB), non animal origin, irradiated for microbiology.

Référence : 2129869

Unité de vente : 5 kg

Tryptic Soy Broth irradiated (sterile) for microbiology - Merck®

Tryptic Soy Broth (TSB), non animal origin, irradiated for microbiology.

Référence : 4960988

Unité de vente : 500 g

Tryptone Bile Agar (gelose)

Tryptone Bile Agar, for microbiology.

Référence : 8751869

Unité de vente : 500 g

Tryptone Soja extrait de levure bouillon - Fluka®

Tryptone Soy Yeast Extract Broth (TSYEB). For confirmation of Listeria in Henrys light.

Référence : 9459391

Unité de vente : 500 g

Tryptose Sulfite Cyclosérine TSC Gélose, pour microbiologie

Tryptose Sulfite Cycloserine (TSC) Agar

Référence : 2324923

Unité de vente : 500 g

TSS de haute précision, portable - Mesure de MES et turbidité sur site - Hach Lange®

Gamme : 0,001-4,000 FNU et 0,001-400 g/l. Enregistrement des mesures et infos des Ech°

Référence : 4434093

Unité de vente : Coffret

TTACCGTAAACGGAGCCAAC (Forward primer 5'-3')

MABN08 F. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 2450057

Unité de vente : Tube

Page précédente  1, 2, 3 ... 247, 248, 249 ... 254, 255, 256  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion