Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3, 4 ... 118, 119, 120  Page suivante

Acrylamide/Bis-acrylamide 19:1 (ratio), DNase, RNase et protéase, non detectés

Pour Biologie moléculaire

Référence : 2449109

Unité de vente : 100 ml

Acrylamide/Bis-acrylamide 19:1 (ratio), DNase, RNase et protéase, non detectés

Pour Biologie moléculaire

Référence : 8194793

Unité de vente : 5 x 100 ml

Acrylamide/Bis-acrylamide 29:1 (ratio), 40 % solution

Pour électrophorèse

Référence : 3547245

Unité de vente : 5 x 100 ml

Acrylamide/Bis-acrylamide 29:1 (ratio), 40 % solution

Pour électrophorèse

Référence : 9209344

Unité de vente : 100 ml

Actinobacillus pleuropneumoniae ATCC® 27090™ - Lab-Elite™ CRM

Souche ATCC® lyophilisée pure, présentée en écouvillon individuel

Référence : 7306691

Unité de vente : Coffret

Adaptateur pour lecture de PetriFilm®, Sanita-kun®, Compact Dry®, sur compteur Scan®100

Adaptateur multi-supports.

Référence : 3207981

Unité de vente : Pièce

Aerococcus viridans ATCC® 10400™ - Lab-Elite™ CRM

Souche ATCC® lyophilisée non calibrée présentée en écouvillon individuel

Référence : 6709976

Unité de vente : Coffret

Aerococcus viridans ATCC® 11563™ - LYFO-DISK™

Souche ATCC® lyophilisée non calibrée présentée en flacon de 6 disques.

Référence : 4401646

Unité de vente : 6

Agar

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 8470263

1 kg

483.64 €HT

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 1208957

10 kg

2688.64 €HT

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 8603080

100 g

99.27 €HT

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 9288970

25 kg

5854.55 €HT

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 9283781

5 kg

1980.68 €HT

 

Agar (microbiology tested, plant cell culture tested, cell culture tested)
Agar-agar, Gum agar (powder)
Référence : 3507618

500 g

260.91 €HT

 

Agar (plant cell culture tested)
Agar plant cell culture tested, powder. Agar agar, Gum Agar.
Référence : 3571513

1 kg

1135.91 €HT

 

Agar (plant cell culture tested)
Agar plant cell culture tested, powder. Agar agar, Gum Agar.
Référence : 6713761

100 g

163.07 €HT

 

Agar (plant cell culture tested)
Agar plant cell culture tested, powder. Agar agar, Gum Agar.
Référence : 6833672

2,5 kg

2330.68 €HT

 

Agar (plant cell culture tested)
Agar plant cell culture tested, powder. Agar agar, Gum Agar.
Référence : 2841062

500 g

581.48 €HT

 

Agar Agar (Cendre 2 à 4,5 %)
Agar-agar, Gum agar (Ash 2 to 4,5 %)
Référence : 4265748

1 kg

400.11 €HT

 

Agar Agar (Cendre 2 à 4,5 %)
Agar-agar, Gum agar (Ash 2 to 4,5 %)
Référence : 7555954

100 g

77.48 €HT

 

Agar Agar (Cendre 2 à 4,5 %)
Agar-agar, Gum agar (Ash 2 to 4,5 %)
Référence : 9894589

250 g

127.91 €HT

 

Agar Agar (Cendre 2 à 4,5 %)
Agar-agar, Gum agar (Ash 2 to 4,5 %)
Référence : 2671692

5 kg

1334.77 €HT

 

Agar Agar (Cendre 2 à 4,5 %)
Agar-agar, Gum agar (Ash 2 to 4,5 %)
Référence : 5309628

500 g

256.93 €HT

 

Agar noble
Noble agar ; agar-agar ; grum agar.
Référence : 6432334

1 kg

1639.77 €HT

 

Agar noble
Noble agar ; agar-agar ; grum agar.
Référence : 7526025

250 g

528.86 €HT

 

Corn Meal Agar / Infusion Mais Viande (gélose)
Production des chlamydospore de C. albicans et la maintenance et culture
Référence : 8894125

500 g

291.14 €HT

 

Agar bactériologique / Bacteriological Agar

Péremption : 36 mois. Certificat d'analyses inclus.

Référence : 5380752

Unité de vente : 500 g

Agar Bacto® / Ingrédient déshydraté ; Ingrédient pour gélose Bacto™ - BD®

Bacto® Agar.

Référence : 7702145

Unité de vente : 454 g

Agar granulé pour bactériologie - BD®

Granulated Agar.

Référence : 9951093

Unité de vente : 500 g

Agarose

      Analysis Note :
     
      The following is a list of properties associated with our agaroses:
        Sulfate content - used as an indicator of purity, since sulfate is the major ionic group present.
     
        Gel strength - the force that must be applied to a gel to cause it to fracture.
       
        Gel point ...

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 5198518

10 g

64.11 €HT

 

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 4428565

100 g

358.75 €HT

 

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 2049285

25 g

148.75 €HT

 

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 8412844

250 g

716.70 €HT

 

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 1196841

50 g

247.39 €HT

 

Agarose p/Biologie moléculaire - BioReagent - (Imp. totale < 1.0 % cendre et < 10 % eau)
DNase, RNase, NICKase non détectées. T° gel point : 36 °C (± 1.5 °C). EEO 0.09-0.13.
Référence : 7939970

500 g

1236.14 €HT

 

Agarose pour électrophorèse des acides nucléiques
Agarose for analytical nucleic acid electrophoresis
Référence : 9402022

100 g

308.64 €HT

 

Agarose pour électrophorèse des acides nucléiques
Agarose for analytical nucleic acid electrophoresis
Référence : 3063610

500 g

793.86 €HT

 

Agarose pour immuno-électrophorèse
Agarose For Immunoelectrophoresis
Référence : 3436665

100 g

565.57 €HT

 

Agarose pour immuno-électrophorèse
Agarose For Immunoelectrophoresis
Référence : 9066358

50 g

308.64 €HT

 

Agarose pour immuno-électrophorèse
Agarose For Immunoelectrophoresis
Référence : 1352474

500 g

1742.05 €HT

 

Agarose Type IV, Special High EEO

Référence : 6177487

100 g

1473.18 €HT

 

Agarose Type IV, Special High EEO

Référence : 6039336

25 g

414.43 €HT

 

AGATAACGCTCGAGATCGCCC (Forward primer 5'-3')

Ma513036776 F. Nombre de bases : 21. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 8153779

Unité de vente : Tube

Agitateur vibrant Multi-Vortex - Vitesse : 500-3000 t/mn - Modèle V-32 Biosan®

Fct° continue ou par impulsion. Vol.max.: 15 ml. Déplacement orbital : 2 mm

Référence : 4260773

Unité de vente : Pièce

Agitateur vibrant Vortex - Vitesse : 2500-4500 t/mn - Modèle SA6 Stuart®

Fonction continue ou par impulsion. Diamètre max.: 30 mm. Déplacement orbital : 4,5 mm

Référence : 1590402

Unité de vente : Pièce

Agitateur vibrant Vortex - Vitesse : 750-3000 t/mn - Modèle V1+ Biosan®

Fonction continue ou par impulsion. Vol.max.: 30 ml. Déplacement orbital : 4 mm

Référence : 7883730

Unité de vente : Pièce

Aiguille hypodermique stérile apyrogène - 23G (0,60 mm) - L.25 mm - Neolus® Terumo®

Paroi fine. Canule et biseau siliconés. Code couleur : bleu. Emballage individuel.

Référence : 3821088

Unité de vente : 100 x 1

Aiguille hypodermique stérile apyrogène - 25G (0,50 mm) - L.16 mm - Neolus® Terumo®

Paroi fine. Canule et biseau siliconés. Code couleur : orange. Emballage individuel.

Référence : 2172607

Unité de vente : 100 x 1

Aiguille hypodermique stérile apyrogène - 27G (0,40 mm) - L.20 mm - Neolus® Terumo®

Paroi normale. Canule et biseau siliconés. Code couleur : blanc. Emballage individuel.

Référence : 1732523

Unité de vente : 100 x 1

Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion