Lustiner
Panier d'achat
1 article
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3 ... 62, 63, 64 ... 143, 144, 145  Page suivante

Fraser (supplément sélectif pour bouillon de)

Conditionnement : Coffret de 10 flacons (qsp 500 ml). Origine : Biokar®.

Référence : 9607345

Unité de vente : Coffret

Fraser (base II, pour bouillon) - Biokar®

Fraser Broth Base II.

Référence : 1090005

Unité de vente : 500 g

Fraser (base pour bouillon) - Biokar®

Fraser Broth Base.

Référence : 3727031

Unité de vente : 500 g

Fraser demi (base pour bouillon) - sans citrate fer III ammoniacal - Biokar®

Bouillon enrichissement primaire sélectif et différentiel de Listeria monocytogènes

Référence : 2983648

Unité de vente : 500 g

Fraser demi (supplément sélectif pour bouillon de)

Conditionnement : Coffret de 10 flacons (qsp 500 ml). Origine : Biokar®.

Référence : 8423969

Unité de vente : Coffret

- -

Synonym: Basic Parafuchsin, Basic Red 9, Magenta™ O, Parafuchsin hydrochloride, Paramagenta hydrochloride, Pararosaniline chloride, Pararosaniline hydrochloride.

Grade : certified by the Biological Stain Commission
Form : powder
Composition : Dye content, ≥ 88 %
pH range : 1.0 - 3....

Fuchsine basique / Basic Fuchsin - Certified by the Biological Stain Commission - 88 %+
Basic Red 9, Magenta™ O, Basic parafuchsin, Parafuchsin hydrochloride, Paramagenta HCl
Référence : 3543654

100 g

843.18 €HT

 

Fuchsine basique / Basic Fuchsin - Certified by the Biological Stain Commission - 88 %+
Basic Red 9, Magenta™ O, Basic parafuchsin, Parafuchsin hydrochloride, Paramagenta HCl
Référence : 5408756

25 g

279.55 €HT

 

Pararosaniline Hydrochlorure - 90 %+ (pour recherches biochimiques)
Pararosaniline Hydrochloride, Basic red, Parafuchsin. [for Biochemical Research].
Référence : 1514475

25 g

178.57 €HT

 

Pararosaniline Hydrochlorure - 90 %+ (pour recherches biochimiques)
Pararosaniline Hydrochloride, Basic red, Parafuchsin. [for Biochemical Research].
Référence : 8664893

5 g

56.94 €HT

 

Pararosaniline Hydrochlorure - 95 %+
Pararosaniline Hydrochloride, Basic red, Parafuchsin.
Référence : 2578976

100 g

244.57 €HT

 

Pararosaniline Hydrochlorure - 95 %+
Pararosaniline Hydrochloride, Basic red, Parafuchsin.
Référence : 8266674

25 g

103.75 €HT

 

Pararosaniline Hydrochlorure - 95 %+
Pararosaniline Hydrochloride, Basic red, Parafuchsin.
Référence : 8532789

500 g

592.89 €HT

 

Pararosaniline Hydrochlorure - 99 %
Basic Fuchsin, Basic Parafuchsin, Basic Red 9, Magenta™ O, Parafuchsin hydrochloride,...
Référence : 3446693

25 g

250.57 €HT

 

Fuchsine de Ziehl (solution) - Biomérieux®

Carbolic Ziehl Fuchsin.

Référence : 4167565

Unité de vente : 500 ml

Fuchsine de Ziehl (solution) / Carbol-Fuchsin solution according to Ziehl-Neelsen

Fuchsine phéniquée en solution selon Ziehl-Neelsen

Référence : 3901295

Unité de vente : 1 litre

Fuchsine de Ziehl (solution) / Carbol-Fuchsin solution according to Ziehl-Neelsen

Fuchsine phéniquée en solution selon Ziehl-Neelsen

Référence : 5922194

Unité de vente : 100 ml

Fuchsine de Ziehl (solution) / Fuchsin solution according to Ziehl

[10 g C2OH2OClN3 + 50 g C6H5OH + 100 ml C2H5OH / l H2O] Microbiologic colourations

Référence : 1513878

Unité de vente : 4 x 2,5 litres

Fuchsine de Ziehl (solution) / Fuchsin solution according to Ziehl

[10 g C2OH2OClN3 + 50 g C6H5OH + 100 ml C2H5OH / l H2O] Microbiologic colourations

Référence : 1846750

Unité de vente : 6 x 100 ml

Fuchsine de Ziehl (solution) / Fuchsin solution according to Ziehl

[10 g C2OH2OClN3 + 50 g C6H5OH + 100 ml C2H5OH / l H2O] Microbiologic colourations

Référence : 2443513

Unité de vente : 1 litre

Fuchsine de Ziehl (solution) / Fuchsin solution according to Ziehl

[10 g C2OH2OClN3 + 50 g C6H5OH + 100 ml C2H5OH / l H2O] Microbiologic colorations

Référence : 7975680

Unité de vente : 100 ml

Fuchsine de Ziehl (solution) / Fuchsin solution according to Ziehl

[10 g C2OH2OClN3 + 50 g C6H5OH + 100 ml C2H5OH / l H2O] Microbiologic colourations

Référence : 8517414

Unité de vente : 2,5 litres

GAAATCGAGGAAAACCGACA (Reverse primer 5'-3')

MABN08 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 5709314

Unité de vente : Tube

GAGGACCAATCTGCGTTCGC (Forward primer 5'-3')

Ma513035997 F. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 5766469

Unité de vente : Tube

Galerie API® 10S p/ident° des Enterobacteriaceae + bacilles à Gram négatif non fastidieux

Coffret de 50 galeries, boites d'incubation, fiches résultats, notice. [10100] Biomérieux®

Référence : 9476757

Unité de vente : Coffret

Galerie API® 20 A pour l'identification des anaérobies - Biomérieux®

=> 25 galeries, milieux, boites d'incubation et fiches de résultats. [20300].

Référence : 8863309

Unité de vente : Coffret

Galerie API® 20 NE, pour identification de Bacilles Gram négatif non entérobactéries

=> 25 galeries, milieux, boites d'incubation et fiches de résultats. [20050] Biomérieux®.

Référence : 3285195

Unité de vente : Coffret

Galerie API® 20 STREP p/identification des streptocoques et germes apparentés Biomérieux®

=> 25 galeries, boites incubation, ampoules API GP Medium et fiches résultats. [20600]

Référence : 9498432

Unité de vente : Coffret

Page précédente  1, 2, 3 ... 62, 63, 64 ... 143, 144, 145  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion