Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3, ... 118, 119, 120  Page suivante

ACAGCAGACGCACACAAACC (Reverse primer 5'-3')

AF268391 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 9641701

Unité de vente : Tube

ACAGCAGCAACAATCTCGTCGT (Reverse primer 5'-3')

DN240063 R. Nombre de bases : 22. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 3501370

Unité de vente : Tube

Acétate solution tampon - pH=4,65 (à 20°C)

 

 

Acétate solution tampon - pH=4,65 (à 20°C)
Acetic acid-Sodium acetate buffer 1:1 pH 4.65
Référence : 9642487

1 litre

21.57 €HT

 

ACGCAGCACAAGTCGTCCA (Reverse primer 5'-3')

Ma513035997 R. Nombre de bases : 19. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 5195326

Unité de vente : Tube

ACGGAAAACCACAAGCAATC (Reverse primer 5'-3')

MABN26 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 1139297

Unité de vente : Tube

ACGGAGCAGTAACACGGGATTG (Reverse primer 5'-3')

Ma513019043 R. Nombre de bases : 22. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 4922613

Unité de vente : Tube

Acide EthylèneDiamineTétraacétique

Application : Chelator of divalent cations. Inhibits enzymes, such as metalloproteases, that require divalent cations for activity.

Total impurities :
 ≤ 0,005 % insolubles,
 ≤ 0,1 % nitrilotriacetic acid (NTA),

mp : 248°C (dec.) (lit.)
Anion traces :
- chloride (Cl-) : ≤ 50 mg/kg
- sulfate (SO42-) : ≤ 100 mg/kg
Cation traces :
- Fe : ≤ 0,005 %,
- Pb : ≤ 0,002 %,
Foreign activity : DNase, RNase and protease, none detected

Acide EthylèneDiamineTétraacétique sel de disodium dihydraté ACS 99-101,0 %
Disodium ethylenediaminetetraacetate dihydrate, Edathamil, Edetate disodium salt dihydrate
Référence : 1882350

100 g

56.48 €HT

 

Acide EthylèneDiamineTétraacétique sel de disodium dihydraté ACS 99-101,0 %
Disodium ethylenediaminetetraacetate dihydrate, Edathamil, Edetate disodium salt dihydrate
Référence : 6187929

500 g

195.68 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 8021625

1 kg

159.00 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 5728854

100 g

71.59 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 8695976

2,5 kg

718.18 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 8505740

250 g

123.86 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 9495660

5 kg

1363.64 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 8345401

50 g

64.32 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - 98,5-101,5 %
EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2.
Référence : 3349198

500 g

207.50 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - Ph. Eur. P.A. 99-101%
Idranal® III. EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2
Référence : 2773797

1 kg

172.84 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - Ph. Eur. P.A. 99-101%
Idranal® III. EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2
Référence : 7840238

100 g

29.40 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - Ph. Eur. P.A. 99-101%
Idranal® III. EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2
Référence : 9060957

50 g

19.20 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O - Ph. Eur. P.A. 99-101%
Idranal® III. EDTA disodium salt dihydrate. Edathamil. Sequestrene Na2
Référence : 5724389

6 x 1 kg

902.61 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, 99 %+ (testé pour culture cellulaire)
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 4287397

1 kg

427.16 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, 99 %+ (testé pour culture cellulaire)
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 5962234

100 g

66.98 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, 99 %+ (testé pour culture cellulaire)
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 6575631

500 g

230.68 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 2274837

1 kg

321.36 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 9654305

100 g

58.07 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 9573006

250 g

111.36 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 3437527

5 kg

1291.82 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 8023850

50 g

36.59 €HT

 

Acide EthylèneDiamineTétraacétique, Na2 - 2H2O, pour Biologie moléculaire 99-101 %
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 9276898

500 g

153.52 €HT

 

Acide Tétraacétique Ethylène Diamine disodium sel dihydraté Ph. Eur., BP, USP 99.0-101 %+
EDTA disodium salt, Edetate disodium salt dihydrate, Edathamil, Sequestrene Na2
Référence : 2297332

1 kg

337.27 €HT

 

Acide Tétraacétique Ethylène Diamine disodium sel dihydraté Ph. Eur., BP, USP 99.0-101 %+
EDTA disodium salt, Edetate disodium salt dihydrate, Edathamil, Sequestrene Na2
Référence : 1209427

500 g

237.05 €HT

 

Acide Tétraacétique Ethylène Diamine disodium sel dihydraté Ph. Eur., BP, USP 99.0-101 %+
EDTA disodium salt, Edetate disodium salt dihydrate, Edathamil, Sequestrene Na2
Référence : 1194926

6 x 1 kg

1716.59 €HT

 

Edetate disodium - Standard de référence de la Pharmacopée Américaine
Edathamil, Edetate disodium salt dihydrate, EDTA disodium salt, Sequestrene Na2
Référence : 5886643

200 mg

561.21 €HT

 

EDTA sel de di-sodium / Disodium édétate 2H2O - Solution volumétrique à 0,01 M
EDTA disodium salt, solution volumetric. [3,723 g EDTA / l H2O = 0.01 M (±0.00004/20°C)].
Référence : 6120152

1 litre

68.99 €HT

 

EDTA sel de di-sodium / Disodium édétate 2H2O - Solution volumétrique à 0,01 M
EDTA disodium salt, solution volumetric. [3,723 g EDTA / l H2O = 0.01 M (±0.00004/20°C)].
Référence : 6860317

5 litres

77.54 €HT

 

EDTA sel de di-sodium / Disodium édétate 2H2O - Solution volumétrique à 0,05 M - Titrex®
EDTA disodium salt, solution volumetric. [18,612 g EDTA / l H2O = 0.05 M (±0.0002/20°C)].
Référence : 8912291

1 litre

 

Acide EthylèneDiamineTétraAcétique sel tetrasodium hydraté - BioUltra - 99,0 %+

Impurities : insoluble matter, passes filter test.
mp = 248°C (dec.) (lit.)
Anion traces :
- chloride (Cl-) : ≤ 100 mg/kg
- sulfate (SO42-) : ≤ 100 mg/kg
Cation traces :
 Al: ≤5 mg/kg
 As: ≤0.1 mg/kg
 Ba: ≤5 mg/kg
 Bi: ≤5 mg/kg
 Ca: ≤10 mg/kg
 Cd: ≤5 mg/kg
 Co: ...

Acide EthylèneDiamineTétraAcétique, sel tetrasodium hydraté - BioUltra - 99,0 %+
EDTA tetrasodium salt, Edathamil, Tetrasodium ethylenediaminetetraacetate hydrate
Référence : 7562484

1 kg

271.82 €HT

 

Acide EthylèneDiamineTétraAcétique, sel tetrasodium hydraté - BioUltra - 99,0 %+
EDTA tetrasodium salt, Edathamil, Tetrasodium ethylenediaminetetraacetate hydrate
Référence : 5458864

250 g

89.91 €HT

 

Acide EthylèneDiamineTétraAcétique, sel tetrasodium hydraté - BioUltra - 99,0 %+
EDTA tetrasodium salt, Edathamil, Tetrasodium ethylenediaminetetraacetate hydrate
Référence : 2704494

50 g

53.84 €HT

 

Acide heptafluorobutyrique -

Propriétés :
Vapor density : 7 (vs air)
Vapor pressure : 10 mmHg (25°C)
Refractive index : n20/D = 1,3 (lit.),
bp = 120°C / 755 mmHg (lit.)
Density : 1.645 g/mL at 25°C (lit.).

Acide heptafluorobutyrique - 98 %
Edman Reagent No.3, HFBA, Perfluorobutyric acid
Référence : 9863367

100 g

244.60 €HT

 

Acide heptafluorobutyrique - 98 %
Edman Reagent No.3, HFBA, Perfluorobutyric acid
Référence : 5090456

25 g

95.63 €HT

 

Acide heptafluorobutyrique - 98 %
Edman Reagent No.3, HFBA, Perfluorobutyric acid
Référence : 1438337

5 g

58.98 €HT

 

Acide heptafluorobutyrique - 0,5 ml/l dans l'eau (pour LC-MS)
Edman Reagent No.3, HFBA, Perfluorobutyric acid (Ion-Pair Reagent for LC-MS)
Référence : 1651912

10 ml

79.05 €HT

 

Acide heptafluorobutyrique - 0,5 ml/l dans l'eau (pour LC-MS)
Edman Reagent No.3, HFBA, Perfluorobutyric acid (Ion-Pair Reagent for LC-MS)
Référence : 5408222

100 ml

424.90 €HT

 

Acide heptafluorobutyrique - 99 % (pour analyses des séquence de protéines)
Edman Reagent No.3, HFBA, Perfluorobutyric acid (for protein sequence analysis)
Référence : 7446814

100 ml

1082.35 €HT

 

Acide heptafluorobutyrique - 99 % (pour analyses des séquence de protéines)
Edman Reagent No.3, HFBA, Perfluorobutyric acid (for protein sequence analysis)
Référence : 6115127

150 ml

1484.88 €HT

 

Acide heptafluorobutyrique - 99,5 %+ (pour chromatographie ionique)
Edman Reagent No.3, HFBA, Perfluorobutyric acid
Référence : 8169689

25 ml

184.55 €HT

 

Acide heptafluorobutyrique - 99,5 %+ (pour chromatographie ionique)
Edman Reagent No.3, HFBA, Perfluorobutyric acid
Référence : 1377251

5 ml

50.11 €HT

 

Acide lactique (supplément) modifié / Lactic Acid Supplement, modified - Merck®

Lactic Acid Supplement, modified.

Référence : 2144411

Unité de vente : 5 ampoules

Acinetobacter baumannii ATCC® 19606™ - KWIK-STICK™

Souche ATCC® lyophilisée non calibrée presentée en écouvillon individuel

Référence : 8115343

Unité de vente : 2

Acinetobacter baumannii ATCC® 19606™ - KWIK-STICK™

Souche ATCC® lyophilisée non calibrée presentée en écouvillon individuel

Référence : 4903469

Unité de vente : 6

Acinetobacter baumannii derived from ATCC® 19606™ - LYFO DISK™

Souche ATCC® lyophilisée non calibrée présentée en flacon de 6 disques.

Référence : 1246079

Unité de vente : 6

Acrylamide/Bis-acrylamide 19:1 (ratio), 40 % solution - BioReagent

Pour électrophorèse

Référence : 2109954

Unité de vente : 100 ml

Acrylamide/Bis-acrylamide 19:1 (ratio), 40 % solution - BioReagent

Pour électrophorèse

Référence : 5724814

Unité de vente : 5 x 100 ml

Acrylamide/Bis-acrylamide 19:1 (ratio), DNase, RNase et protéase, non detectés

Pour Biologie moléculaire

Référence : 2001153

Unité de vente : 1 litre

Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion