Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3 ... 279, 280, 281 ... 294, 295, 296  Page suivante

TGGGCAAAGACCGGAAGC (Reverse primer 5'-3')

Ma513043179 F. Nombre de bases :18. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 1766549

Unité de vente : Tube

TGGTTGGTGGCTTGCAAACG (Forward primer 5'-3')

MA513032586 F. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 4097423

Unité de vente : Tube

Théobromine 98,5 %+

Synonymes : 2,6-Dihydroxy-3,7-dimethylpurine, 3,7-Dihydro-3,7-dimethyl-1H-purine-2,6-dione, 3,7-Dimethylxanthine.

bp = 345-350°C.

Théobromine 98,5 %+
2,6-Dihydroxy-3,7-dimethylpurine, 3,7-Dihydro-3,7-dimethyl-1H-purine-2,6-dione...
Référence : 3389424

100 g

160.85 €HT

 

Théobromine 98,5 %+
2,6-Dihydroxy-3,7-dimethylpurine, 3,7-Dihydro-3,7-dimethyl-1H-purine-2,6-dione...
Référence : 7939302

25 g

63.48 €HT

 

Theophylline anhydre 99 %+

Synonymes : 1,3-Dimethylxanthine, 2,6-Dihydroxy-1,3-dimethylpurine, 3,7-Dihydro-1,3-dimethyl-1H-purine-2,6-dione

Color : white  
Solubility :
 H2O: slightly soluble 8.3 mg/ml  
 NH4OH: soluble 50 mg/ml, clear, colorless  
 alcohol: soluble 12.5 mg/ml  
 chloroform: soluble 9.1 mg/ml  
 0....

Theophylline anhydre 99 %+
1,3-Dimethylxanthine, 2,6-Dihydroxy-1,3-dimethylpurine, 3,7-Dihydro-1,3-dimethyl-1H-purine
Référence : 4977813

1 kg

431.82 €HT

 

Theophylline anhydre 99 %+
1,3-Dimethylxanthine, 2,6-Dihydroxy-1,3-dimethylpurine, 3,7-Dihydro-1,3-dimethyl-1H-purine
Référence : 5949622

100 g

93.27 €HT

 

Theophylline anhydre 99 %+
1,3-Dimethylxanthine, 2,6-Dihydroxy-1,3-dimethylpurine, 3,7-Dihydro-1,3-dimethyl-1H-purine
Référence : 1331841

250 g

173.38 €HT

 

Theophylline anhydre 99 %+
1,3-Dimethylxanthine, 2,6-Dihydroxy-1,3-dimethylpurine, 3,7-Dihydro-1,3-dimethyl-1H-purine
Référence : 7959487

50 g

50.52 €HT

 

Thermomètre de référence HA-1524-P4-256 avec malette

2 voies une sonde 5615-12-P PRT, Connecteur TC INFO-CON universel, TPAK

Référence : 7505072

Unité de vente : Pièce

Thermomètre p/Ultra-freezer [-90...-20°C - Div.: 1,0°C], avec traçabilité NIST - L.:145 mm

Base PE blanc (ralentisseur thermique) avec thermomètre gainé téflon. Liquide écologique

Référence : 1241540

Unité de vente : Pièce

Thermomètre portable 2 voies de mesure TC et RTD - Modèle TM 6630 + Accessoires

Haute précision : 0.02% PE - Résolution 0.01 °C. Ajustable.

Référence : 6619056

Unité de vente : Pièce

Thermomètre portable 2 voies pour sondes résistives [-200°C...850°C] - Modèle TTI-10

Mémoire : 4000 mesures avec horodatage. Dim°.: L.200 x P.85 x H.40 mm.

Référence : 8843561

Unité de vente : Pièce

Thermomètre portable 2 voies pour sondes résistives [-200°C...850°C] - Modèle TTI-10 + REF

Mémoire : 4000 mesures avec horodatage. Dim°.: L.200 x P.85 x H.40 mm.

Référence : 3254560

Unité de vente : Pièce

Thermomètre portable 2 voies pour sondes résistives [-200°C...850°C] - Modèle TTI-10+Sonde

Mémoire : 4000 mesures avec horodatage. Dim°.: L.200 x P.85 x H.40 mm.

Référence : 5291221

Unité de vente : Pièce

Thermomètre pour congélateur [-30...-1°C - Div.: 0,5°C], avec traçabilité NIST - L.:115 mm

Base PE blanc (ralentisseur thermique) avec thermomètre gainé téflon. Liquide écologique

Référence : 2775897

Unité de vente : Pièce

Thermomètre pour étuve [+20...+130°C - Div.: 1,0°C], avec traçabilité NIST - L.:135 mm

Base PE blanc (ralentisseur thermique) avec thermomètre gainé téflon. Liquide écologique

Référence : 2842130

Unité de vente : Pièce

Thermomètre pour incubateur [-5...+15°C - Div.: 0,5°C], avec traçabilité NIST - FRIO-Temp®

Long.150 mm. Base flacon avec liquide écologique et thermomètre gainé téflon.

Référence : 1683059

Unité de vente : Pièce

Thermomètre pour incubateur [+20...+50°C - Div.: 0,5°C], avec traçabilité NIST FRIO-Temp®

Long.150 mm. Base flacon avec liquide écologique et thermomètre gainé téflon.

Référence : 8916334

Unité de vente : Pièce

Thiamine Impureté E - CRM - Standard Pharmaceutique secondaire

Synonymes : Thioxothiamine, 3-[(4-Amino-2-methylpyrimidin-5-yl)methyl]-5-(2-hydroxyethyl)-4-methylthiazol-2(3H)-thione.

Thiamine Impurity E is an impurity of B class vitamins such as thiamine. Thiamine is important for primary metabolism for all living organisms and is also used in the ...

Thiamine Impureté E - CRM - Standard Pharmaceutique secondaire
Thiamine impurity E CRM ; Aneurine hydrochloride ; Vitamin B1 hydrochloride
Référence : 5439779

20 mg

655.71 €HT

 

CAS 67-03-8

Synonyme(s) : Thiamine hydrochloride, Aneurine hydrochloride, Vitamin B1 hydrochloride.

 

Loratadine SCR - Standard de référence de la Pharmacopée Européenne
Loratadine CRS - European Pharmacopoeia (EP) Reference Standard
Référence : 4799051

60 mg

224.38 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 9541255

1 kg

862.27 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 9127414

10 g

29.75 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 9761959

100 g

151.45 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 9276234

25 g

39.93 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 5905420

250 g

283.98 €HT

 

Thiamine hydrochlorure - 99 %+
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 3127047

5 g

20.36 €HT

 

Thiamine hydrochlorure USP
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 6900168

25 g

44.39 €HT

 

Thiamine hydrochlorure USP
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 3553812

250 g

451.02 €HT

 

Thiamine hydrochlorure (testé pour culture cellulaire végétale) - BioReagent
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 4377044

100 g

 

Thiamine hydrochlorure (testé pour culture cellulaire végétale) - BioReagent
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 3777586

100 g

210.51 €HT

 

Thiamine hydrochlorure (testé pour culture cellulaire végétale) - BioReagent
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 5588346

25 g

 

Thiamine hydrochlorure (testé pour culture cellulaire végétale) - BioReagent
Aneurine hydrochloride, Vitamin B1 hydrochloride
Référence : 3769521

25 g

62.90 €HT

 

Thiamine hydrochlorure SCR - Standard de référence de la Pharmacopée Américaine
Thiamine hydrochloride CRS ; Aneurine hydrochloride ; Vitamin B1 hydrochloride
Référence : 6982081

10 mg

607.66 €HT

 

Thiamine hydrochlorure SCR - Standard de référence de la Pharmacopée Européenne
Thiamine hydrochloride CRS ; Aneurine hydrochloride ; Vitamin B1 hydrochloride
Référence : 8605175

10 mg

224.38 €HT

 

Thiamine pour conformité de système - Standard de référence de la Pharmacopée Européenne
Aneurine hydrochloride, Thiamine hydrochloride, Vit. B1 hydrochloride f/system suitability
Référence : 1128320

500 µg

224.38 €HT

 

Thidiazuron - Standard analytique certifié - Pestanal®

Legal Information PESTANAL is a registered trademark of Sigma-Aldrich Biotechnology LP and Sigma-Aldrich Co.

Thidiazuron - Standard analytique certifié - Pestanal®
Thidiazuron Pestanal® analytical standard
Référence : 1958792

250 mg

84.00 €HT

 

Thioacétamide

Thioacétamide pour analyses - 99 %+ - [C2H5NS]. For laboratory use, ACS, Ph. Eur.

Physical
    Form: crystals
    Colour: colourless
    Melting point: 111-114°C
    Density: 1,37 g/cm3
    Mol Weight: 75.14 g/mol
    Storage temp: RT

Specs
    Assay >99%
    Melting Point : 111 - ...

Thioacétamide 98 %
Ethanethioamide
Référence : 4258262

100 g

128.55 €HT

 

Thioacétamide 98 %
Ethanethioamide
Référence : 7642533

25 g

42.48 €HT

 

Thioacétamide 98 %
Ethanethioamide
Référence : 6298013

500 g

513.86 €HT

 

Thioacétamide ACS 99,0 %
Ethanethioamide
Référence : 2359008

100 g

166.19 €HT

 

Thioacétamide ACS 99,0 %
Ethanethioamide
Référence : 3750317

25 g

57.02 €HT

 

Thioacétamide ACS 99,0 %
Ethanethioamide
Référence : 3908515

500 g

580.57 €HT

 

Thioacétamide ACS 99,0 %+ (pour précipitations des métaux lourds)
Ethanethioamide
Référence : 6175465

1 kg

1291.55 €HT

 

Thioacétamide ACS 99,0 %+ (pour précipitations des métaux lourds)
Ethanethioamide
Référence : 7053254

250 g

390.64 €HT

 

Thioacétamide ACS 99,0 %+ (pour précipitations des métaux lourds)
Ethanethioamide
Référence : 2953186

50 g

102.98 €HT

 

Thioacétamide P.A. ACS Ph. Eur. 99,0 %+
Ethanethioamide.
Référence : 4570886

250 g

1647.64 €HT

 

Thioacétamide P.A. ACS Ph. Eur. 99,0 %+
Ethanethioamide.
Référence : 3911616

50 g

403.55 €HT

 

Thioacétamide - P.A. ACS Ph. Eur. 99,0 %+
Ethanethioamide. For laboratory use.
Référence : 1071764

50 g

211.33 €HT

 

Thiocarbohydrazide 98

bp = 150 - 153°C (lit.)

Thiocarbohydrazide 98 %
Thiocarbonyldihydrazide
Référence : 2949959

100 g

1296.76 €HT

 

Thiocarbohydrazide 98 %+
Thiocarbonyldihydrazide
Référence : 9494864

25 g

181.16 €HT

 

Thiocarbohydrazide 98 %+
Thiocarbonyldihydrazide
Référence : 3314387

5 g

67.57 €HT

 

Page précédente  1, 2, 3 ... 279, 280, 281 ... 294, 295, 296  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion