Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3 ... 312, 313, 314 ... 321, 322, 323  Page suivante

Trizma® hydrochloride 99,0 %+ for molecular biology Biotechnology Performance Certified

Propriétés
grade Biotechnology Performance Certified
  for molecular biology
assay ≥99.0% (titration)
total impurities DNase, RNase, protease, none detected
  endotoxin and bioburden, tested
  ≤0.5% water (Karl Fischer)
useful pH range 7.0 - 9.0
pKa (25 °C) 8.1
EQP level Elite
mp 150-152 °C
solubility H2O: soluble667 mg/mL
cation traces heavy metals (as Pb): ≤5 ppm
abs. A40%/290 ≤0.05
suitability cell culture tested

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
 Référence : 1745395

1 kg

431.14 €HT

 

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
 Référence : 4024195

100 g

69.68 €HT

 

Trizma® hydrochloride 99,0 %+ for molecular biology, Biotechnology Performance Certified
TRIS HCl, TRIS hydrochloride, Tris(hydroxymethyl)aminomethane hydrochloride
 Référence : 8584050

500 g

286.36 €HT

 

Trompe à eau anti-retour, en verre borosilicaté 3.3 MBL™ - Vide modéré jusquà 65 mbar

Dim°.: Ø.corps x H.tot : 20 x 240 mm. P°. eau : 1 bar. Cons°. eau : 17 l/h.

Référence : 7408476

Unité de vente : Pièce

75.73 €HT

 Ajouter au panier

Voir la fiche descriptive

Trypsine (inhibiteur) à base d'oeuf de poule / Trypsin inhibitor from chicken egg white

Description :
Analysis Note : One mg will inhibit 0.8-1.2 mg of tryspin with activity of approx. 10,000 BAEE units per mg protein. May inhibit ≤0.3 mg of chymotrypsin with activity of approx. 40 BTEE units per mg protein.
Other Note : Ovomucoid, from chicken egg white, does not itself inhibit chymotrypsin. Chymotrypsin inhibition is a measure of ovoinhibitor contamination by method of Feeney, R. E., et al., J. Biol. Chem., 238, 1415 (1963).
Unit Definition : One trypsin unit will produce a ΔA253 of 0.001 per min with BAEE as substrate at pH 7.6 at 25 °C; reaction volume 3.2 mL, 1 cm light path.
Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 2081570

1 g

307.67 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 5871056

250 mg

99.53 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 8322501

5 g

1198.30 €HT

 

Trypsine (inhibiteur), à base d'oeuf de poule / Trypsin inhibitor from chicken egg white
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 9822482

500 mg

186.98 €HT

 

CAS 9002-07-7

Températrue de stockage : -20 °C.
Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 5161989

1 g

176.18 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 4866157

10 g

1321.36 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 6810377

100 mg

59.76 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 6321883

5 g

738.41 €HT

 

Trypsine (issu de pancréas bovin) déshydratée, >7,500 BAEE units/mg solide
Type II-O, Partially purified ovomucoid, containing ovoinhibitor - Ovomucoid
 Référence : 4733694

500 mg

84.46 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
 Référence : 5335559

10 g

51.19 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
 Référence : 8155281

100 g

249.20 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
 Référence : 9924873

25 g

94.08 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
 Référence : 3813182

5 g

28.01 €HT

 

Trypsine BioReagent (à partir de pancreas porcin), pour culture cellulaire
Lyophilized powder, BioReagent, suitable for cell culture, 1,000-2,000 BAEE units/mg solid
 Référence : 4240242

500 g

1149.43 €HT

 

Trypsine-EDTA solution 10x
0.5% trypsin, 0.2% EDTA, trypsin gamma irrdiated by SER-TAIN Process, without phenol red,
 Référence : 6041031

100 ml

35.25 €HT

 

Tryptic Soy (CASO) broth irradiated (sterile) - Merck®

Casein-peptone soymeal-peptone broth USP for microbiology.

Référence : 8882965

Unité de vente : 500 g

220.00 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptic Soy Agar (TSA)/Trypticase Soja gélose, selon EP, USP, JP, ISO, FDA-BAM GranuCult™

Casein-peptone soyameal-peptone agar, Cacein-peptone soyameal-peptone agar. Merck®.

Référence : 2864224

Unité de vente : 500 g

233.00 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptic Soy Broth irradiated (sterile) for microbiology - Merck®

Tryptic Soy Broth (TSB), non animal origin, irradiated for microbiology.

Référence : 2129869

Unité de vente : 5 kg

1965.63 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptic Soy Broth irradiated (sterile) for microbiology - Merck®

Tryptic Soy Broth (TSB), non animal origin, irradiated for microbiology.

Référence : 4960988

Unité de vente : 500 g

205.42 €HT

 Ajouter au panier

Voir la fiche descriptive

Trypticase Soja (bouillon) - Milieu Ph. Eur. A - BD®

Tryptic Soy Broth (TSB). Origine : Becton Dickinson®.

Référence : 1329155

Unité de vente : 500 g

194.99 €HT

 Ajouter au panier

Voir la fiche descriptive

Trypticase Soja (gélose) / Tryptic Soy Agar (TSA) - Milieu Ph. Eur. B - Difco™

Soybean-Casein Digest Agar Medium. Origine : BD®.

Référence : 9005651

Unité de vente : 500 g

167.37 €HT

 Ajouter au panier

Voir la fiche descriptive

Trypticase Soja (gélose) avec lécithine et Polysorbate 80 - BD®

BBL™ Trypticase™ Soy Agar with Lecithin and Polysorbate 80

Référence : 5872893

Unité de vente : 500 g

169.97 €HT

 Ajouter au panier

Voir la fiche descriptive

Trypticase Soja Bouillon (TSB) - Stérile - Bouchage septum + opercule - BD™

Stérilisé à l'oxyde d'éthylène Stericlin® (p/Salles Propres). Test de stérilité USP/EP

Référence : 7036542

Unité de vente : 44 x 100 ml

412.22 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptone Bile Agar (gelose)

Tryptone Bile Agar, for microbiology.

Référence : 8751869

Unité de vente : 500 g

202.73 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptone Soja extrait de levure bouillon - Fluka®

Tryptone Soy Yeast Extract Broth (TSYEB). For confirmation of Listeria in Henrys light.

Référence : 9459391

Unité de vente : 500 g

96.91 €HT

 Ajouter au panier

Voir la fiche descriptive

Tryptose Sulfite Cyclosérine TSC Gélose, pour microbiologie

Tryptose Sulfite Cycloserine (TSC) Agar

Référence : 2324923

Unité de vente : 500 g

167.42 €HT

 Ajouter au panier

Voir la fiche descriptive

TSI (gélose) / Triple Sugar Iron Agar - BD® Difco™

F/differentiation of gram-negative enteric bacilli based on carbohydrate fermentation...

Référence : 1122597

Unité de vente : 500 g

216.99 €HT

 Ajouter au panier

Voir la fiche descriptive

TSS de haute précision, portable - Mesure de MES et turbidité sur site - Hach Lange®

Gamme : 0,001-4,000 FNU et 0,001-400 g/l. Enregistrement des mesures et infos des Ech°

Référence : 4434093

Unité de vente : Coffret

6688.31 €HT

 Ajouter au panier

Voir la fiche descriptive

TTACCGTAAACGGAGCCAAC (Forward primer 5'-3')

MABN08 F. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 2450057

Unité de vente : Tube

29.55 €HT

 Ajouter au panier

Voir la fiche descriptive

Tube à centrifuger gradué (PP) à fond conique, bouché, stérile - 50 mL

FCR : 15000 xg. Dim°.: Ø.28 x H.115 mm. Résiste de 0 °C à 40 °C.

Référence : 4281706

Unité de vente : 20 x 25

114.49 €HT

 Ajouter au panier

Voir la fiche descriptive

Tube à centrifuger gradué (PP) à fond conique, bouché, stérile - 50 mL - Corning™ Falcon®

FCR : 16000 xg. Dim°.: Ø.30 x H.115 mm. Résiste de T°amb jusqu'à -80°C.

Référence : 2724912

Unité de vente : 20 x 25

144.61 €HT

 Ajouter au panier

Voir la fiche descriptive
Page précédente  1, 2, 3 ... 312, 313, 314 ... 321, 322, 323  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion