Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

Des guillemets peuvent êtres utilisés pour effectuer une recherche sur un texte précis

:

:

:

Page précédente  1, 2, 3 ... 66, 67, 68 ... 142, 143, 144  Page suivante

Geobacillus stearothermophilus ATCC® 12980™ - EZ-Accu Shot™

Souche calibrée C<100 CFU/0,1ml. Conforme Pharmacopée. Ss dilution.[5 x 1,2 ml (50 tests)]

Référence : 8975436

Unité de vente : Coffret

Voir la fiche descriptive

Geobacillus stearothermophilus ATCC® 12980™ - EZ-CFU™

Souche calibrée 10 à 100 CFU/0.1ml. Condt : 2 flacons de 10 disques, pour 10 tests

Référence : 2244042

Unité de vente : 20

Voir la fiche descriptive

GGAACCACGTGTCCTGATCT (Reverse primer 5'-3')

MABN17 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 4883938

Unité de vente : Tube

29.55 €HT

 Ajouter au panier

Voir la fiche descriptive

GGATCCATGGCGATGACCC (Reverse primer 5'-3')

DN238160 R. Nombre de bases : 19. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 1200058

Unité de vente : Tube

28.07 €HT

 Ajouter au panier

Voir la fiche descriptive

GGGCCTTCCATTGGGAGAAAG (Forward primer 5'-3')

DN239853 F. Nombre de bases : 21. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 2389840

Unité de vente : Tube

31.02 €HT

 Ajouter au panier

Voir la fiche descriptive

Giemsa stain modified

 

 
Giemsa stain, modified
Giemsa Solution
 Référence : 9061059

1 litre

106.19 €HT

 

Giemsa stain, modified solution for staining of cellular blood components, blood parasites
Azure eosin methylene blue, Giemsa solution.
 Référence : 3354215

1 litre

160.64 €HT

 

Giemsa stain, modified solution for staining of cellular blood components, blood parasites
Azure eosin methylene blue, Giemsa solution.
 Référence : 7559357

100 ml

66.72 €HT

 

Giemsa stain, modified solution for staining of cellular blood components, blood parasites
Azure eosin methylene blue, Giemsa solution.
 Référence : 7843299

500 ml

98.89 €HT

 

Gilet Softshell sans manche, en softshell 150D - Col montant et fermeture zip - Taille XXL

Membrane étanche et respirante. Poches : 1 poitrine, 2 intérieures, 2 extérieures plaquées

Référence : 8874005

Unité de vente : Pièce

55.60 €HT

 Ajouter au panier

Voir la fiche descriptive

Glimepiride Standard de Référence de la Pharmacopée

 

 

 
Glimepiride - Standard de Référence de la Pharmacopée Américaine
Glimepiride - United States Pharmacopeia (USP) Reference Standard
 Référence : 5114185

200 mg

981.18 €HT

 

Glimepiride CRS - Standard de Référence de la Pharmacopée Européenne
Glimepiride SCR - European Pharmacopeia (EP) Reference Standard
 Référence : 5595452

110 mg

190.96 €HT

 

Glimepiride p/conformité du système CRS Standard de Référence de la Pharmacopée Européenne
Glimepiride for system suitability SCR - European Pharmacopeia (EP) Reference Standard
 Référence : 6680569

0,012 mg

190.96 €HT

 

Glimepiride Composé apparenté B - Standard de Référence de la Pharmacopée Américaine

Synonym: 4-{2-[(3-Ethyl-4-methyl-2-oxo-3-pyrrolin-1-yl)carboxamido]ethyl}benzenesulfonamide, Glimepiride sulfonamide.

 
Glimepiride Composé apparenté B - Standard de Référence de la Pharmacopée Américaine
Glimepiride Related Compound B - United States Pharmacopeia (USP) Reference Standard
 Référence : 5625424

20 mg

1936.64 €HT

 

Glimepiride Composé apparenté C - Standard de Référence de la Pharmacopée Américaine

Synonym: (glimepiride urethane, or methyl ((4-(2-(3-ethyl-4-methyl-2-oxo-2,5-dihydro-1H-pyrrole-1-carboxamido)ethyl)phenyl)sulfonyl)carbamate).

 
Glimepiride Composé apparenté C - Standard de Référence de la Pharmacopée Américaine
Glimepiride Related Compound C - United States Pharmacopeia (USP) Reference Standard
 Référence : 5812943

20 mg

2001.09 €HT

 

Glimepiride p/ident° de l'impureté A - Standard de Référence de la Pharmacopée Européenne

Glimepiride for impurity A identification - European Pharmacopeia (EP) Reference Standard

Référence : 9286340

Unité de vente : 5 mg

190.96 €HT

 Ajouter au panier

Voir la fiche descriptive

Glucose standard solution - 1 mg/ml (contient 0,1% acide Benzoïque)

Pour kit d'analyse enzymatique du glucose, réf.: 1838708.

Référence : 8595093

Unité de vente : 100 ml

103.88 €HT

 Ajouter au panier

Voir la fiche descriptive

CAS 56-81-5

Application : Glycerol is used both in sample preparation and gel formation for polyacrylamide gel electrophoresis. Glycerol (5-10%) increases the density of a sample so that the sample will layer at the bottom of a gel's sample well. Glycerol is also used to aid in casting gradient gels and as a ...
Glycérine - DAB, Ph. Eur., BP, Ph. Franç., USP, FCC 99 %+
Glycerin. 1,2,3-Propanetriol. For laboratory use
 Référence : 6987617

1 litre

99.04 €HT

 

Glycérine - DAB, Ph. Eur., BP, Ph. Franç., USP, FCC 99 %+
Glycerin. 1,2,3-Propanetriol. For laboratory use
 Référence : 4238304

2,5 litres

193.46 €HT

 

Glycérine - DAB, Ph. Eur., BP, Ph. Franç., USP, FCC 99 %+
Glycerin. 1,2,3-Propanetriol. For laboratory use
 Référence : 3162441

4 x 2,5 litres

670.65 €HT

 

Glycérine - DAB, Ph. Eur., BP, Ph. Franç., USP, FCC 99 %+
Glycerin. 1,2,3-Propanetriol. For laboratory use
 Référence : 7368614

6 x 1 litre

447.85 €HT

 

Glycérine - P.A. ACS 99 %+
Glycerin ; 1,2,3-Propanetriol. For laboratory use.
 Référence : 5878996

1 litre

127.72 €HT

 

Glycérine - P.A. ACS 99 %+
Glycerin ; 1,2,3-Propanetriol. For laboratory use.
 Référence : 2266949

2,5 litres

252.57 €HT

 

Glycérine - P.A. ACS 99 %+
Glycerin ; 1,2,3-Propanetriol. For laboratory use.
 Référence : 5309895

4 x 2,5 litres

761.38 €HT

 

Glycérine - P.A. ACS 99 %+
Glycerin ; 1,2,3-Propanetriol. For laboratory use.
 Référence : 7615786

6 x 1 litre

577.52 €HT

 

Glycérine anhydre, pour biologie moléculaire 99,5 %+
Glycerol anhydrous ; 1,2,3-Propanetriol. For laboratory use, for molecular biology.
 Référence : 1880502

500 ml

100.81 €HT

 

Glycérol 99 % (cell culture tested, insect cell culture tested)
1,2,3-Propanetriol, Glycerin.
 Référence : 1414824

1 litre

241.82 €HT

 

Glycérol 99 % (cell culture tested, insect cell culture tested)
1,2,3-Propanetriol, Glycerin.
 Référence : 2312524

100 ml

108.98 €HT

 

Glycérol 99 % (cell culture tested, insect cell culture tested)
1,2,3-Propanetriol, Glycerin.
 Référence : 1422340

500 ml

224.32 €HT

 

Glycérol 99,0 %+
1,2,3-Propanetriol, Glycerin.
 Référence : 2265763

1 Gallon

385.52 €HT

 

Glycérol 99,0 %+
1,2,3-Propanetriol, Glycerin.
 Référence : 4299830

5 litres

405.48 €HT

 

Glycérol 99,0 %+
1,2,3-Propanetriol, Glycerin.
 Référence : 6879987

500 ml

101.55 €HT

 

Glycérol 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 7684298

1 Gallon

1260.00 €HT

 

Glycérol 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 4158510

1 litre

527.73 €HT

 

Glycérol 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 4000187

100 ml

150.75 €HT

 

Glycérol 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 1471057

2 litres

965.45 €HT

 

Glycérol 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 3228722

500 ml

306.82 €HT

 

Glycérol ACS 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 1659225

1 litre

415.23 €HT

 

Glycérol ACS 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 2424733

2 litres

644.32 €HT

 

Glycérol ACS 99,5 %+
1,2,3-Propanetriol, Glycerin
 Référence : 1823653

500 ml

214.77 €HT

 

Glycérol P.A. 86-89 %
1,2,3-Propanetriol, Glycerin. (solution)
 Référence : 7365492

1 litre

289.66 €HT

 

Glycérol P.A. 86-89 %
1,2,3-Propanetriol, Glycerin. (solution)
 Référence : 4981002

5 litres

1158.48 €HT

 

Glycérol ReagentPlus® 99,0 %+
1,2,3-Propanetriol, Glycerin.
 Référence : 6247723

1 litre

67.07 €HT

 

Glycérol ReagentPlus® 99,0 %+
1,2,3-Propanetriol, Glycerin.
 Référence : 8394835

5 litres

291.02 €HT

 

Glycérol - 83.5-89.5% (T)
Glycerol solution ; 1,2,3-Propanetriol ; Glycerin
 Référence : 7666245

1 litre

231.82 €HT

 

Glycérol anhydre - 99 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 3061419

1 litre

219.55 €HT

 

Glycérol anhydre - 99 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 6444941

100 ml

67.30 €HT

 

Glycérol anhydre - 99 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 4757752

500 ml

1215.77 €HT

 

Glycérol anhydre - EMPROVE® bio Ph Eur, BP, JP, USP, ACS 99,5 %+
1,2,3-Propanetriol, Trihydroxylpropane, Protol, Glycerin, 1,2,3-Propanetriol, Glycerin
 Référence : 2761661

1 litre

120.91 €HT

 

Glycérol anhydre - EMPROVE® bio Ph Eur, BP, JP, USP, ACS 99,5 %+
1,2,3-Propanetriol, Trihydroxylpropane, Protol, Glycerin, 1,2,3-Propanetriol, Glycerin
 Référence : 5688759

2,5 litres

218.64 €HT

 

Glycérol anhydre - P.A. ACS 99,5 %+
Glycerol anhydrous. 1,2,3-Propanetriol, Glycerin
 Référence : 3976570

1 litre

510.09 €HT

 

Glycérol anhydre - P.A. ACS 99,5 %+
Glycerol anhydrous. 1,2,3-Propanetriol, Glycerin
 Référence : 2360535

2,5 litres

1113.84 €HT

 

Glycérol anhydre - P.A. ACS 99,5 %+
Glycerol anhydrous. 1,2,3-Propanetriol, Glycerin
 Référence : 6622970

250 ml

131.59 €HT

 

Glycérol anhydre - Ph.Eur. - BP - USP - 99.0-101.0% (alkalimetric)
Meets analytical specification of Ph. Eur., BP, USP, FCC, E422, anhydrous
 Référence : 8910248

1 litre

166.93 €HT

 

Glycérol anhydre - Ph.Eur. - BP - USP - 99.0-101.0% (alkalimetric)
Meets analytical specification of Ph. Eur., BP, USP, FCC, E422, anhydrous
 Référence : 3800248

2,5 litres

317.61 €HT

 

Glycérol anhydre - Ph.Eur. - BP - USP - 99.0-101.0% (alkalimetric)
Meets analytical specification of Ph. Eur., BP, USP, FCC, E422, anhydrous
 Référence : 5296307

6 x 1 litre

1001.59 €HT

 

Glycérol anhydre BioUltra - 99,5 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 9399970

1 litre

347.61 €HT

 

Glycérol anhydre BioUltra - 99,5 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 3158248

100 ml

70.39 €HT

 

Glycérol anhydre BioUltra - 99,5 %+ (pour biologie moléculaire)
1,2,3-Propanetriol, Glycerin
 Référence : 8326320

250 ml

114.86 €HT

 

Glycérol en solution - 86-89 %
1,2,3-Propanetriol. Glycerol solution.
 Référence : 2348904

1 litre

104.20 €HT

 

Glycérol en solution - 86-89 %
1,2,3-Propanetriol. Glycerol solution.
 Référence : 3138623

5 litres

374.66 €HT

 

Glycérol en solution - 86-89 %
1,2,3-Propanetriol. Glycerol solution.
 Référence : 4005308

500 ml

62.20 €HT

 

Glycérol stérile (grade biotechnologie)
Glycerol ; 1,2,3-Propanetriol ; Glycerin (sterile)
 Référence : 8744125

100 ml

 

Glycérol gélatine

Glycerol gelatin. Glycerol jelly. Very similar to Kaiser Glycerol jelly.

Référence : 5533566

Unité de vente : 15 ml

61.19 €HT

 Ajouter au panier

Voir la fiche descriptive

Glycérol gélatine

Glycerol gelatin. Glycerol jelly. Very similar to Kaiser Glycerol jelly.

Référence : 6653674

Unité de vente : 10 x 15 ml

324.72 €HT

 Ajouter au panier

Voir la fiche descriptive

Glycine

      Impurities :
        DNases, none detected  
        RNases, none detected  
        insoluble matter, passes filter test  
        phosphatases, none detected  
        proteases, none detected  
      Ign. residue : &le; 0.05% (as SO4)  
      Loss : &le; 0.05% loss on drying, 20°C (HV)  
      pKa (25°C) = 2.35  
      mp = ...
Glycine (d'origine non animale) - USP, EP, JP, pour culture cellulaire - 98,5 %+
from non-animal source, meets EP,JP, USP testing specifications, suitable for cell culture
 Référence : 8008345

1 kg

207.61 €HT

 

Glycine (d'origine non animale) - USP, EP, JP, pour culture cellulaire - 98,5 %+
from non-animal source, meets EP,JP, USP testing specifications, suitable for cell culture
 Référence : 2891591

100 g

72.55 €HT

 

Glycine BioUltra 99 %+ (pour biologie moléculaire)
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 9328919

1 kg

327.23 €HT

 

Glycine BioUltra 99 %+ (pour biologie moléculaire)
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 9973692

250 g

107.89 €HT

 

Glycine BioUltra 99 %+ (pour biologie moléculaire)
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 1908329

50 g

40.35 €HT

 

Glycine P.A. Ph. Eur. 99,7-101 %
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 5875714

1 kg

80.24 €HT

 

Glycine P.A. Ph. Eur. 99,7-101 %
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 3694429

250 g

45.50 €HT

 

Glycine ReagentPlus® 99 %+
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 6328170

1 kg

127.59 €HT

 

Glycine ReagentPlus® 99 %+
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 2989461

10 mg

35.80 €HT

 

Glycine ReagentPlus® 99 %+
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 4918951

100 g

48.36 €HT

 

Glycine ReagentPlus® 99 %+
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 7106919

5 kg

509.89 €HT

 

Glycine ReagentPlus® 99 %+
Aminoacetic acid, Aminoethanoic acid, Glycocoll
 Référence : 3914609

500 g

82.57 €HT

 

Goat anti-mouse IgG-HRP (supplied at 200 µg in 0.5 ml volume)

horseradish peroxidase conjugated secondary antibody, pre-adsorbed with human IgG

Référence : 7135725

Unité de vente : 200 µg

215.56 €HT

 Ajouter au panier

Voir la fiche descriptive

Gram Stain kit - Coffret pour coloration de Gram - BBL™

Inclus : cristal violet + décolorant + lugol stabilisé + Safranine (flacon doseur 250 ml)

Référence : 6334461

Unité de vente : Coffret

Voir la fiche descriptive

Gram-Hücker R action rapide - Coffret complet contenant : Cristal violet oxalate...

...Liquide lugol stabilisé PVP . Diff rapide (alcool / acétone) et Safranine.

Référence : 8754173

Unité de vente : 4 x 240 ml

Voir la fiche descriptive

Grattoir de cellules, stérile (par irradiation aux rayons gamma), apyrogène - Corning®

P/Flacons de 25 à 75 cm². Dim°.: L.250 x l.18 mm. Emb. individuel."Corning® Cell scrapers"

Référence : 4914892

Unité de vente : 100

363.64 €HT

 Ajouter au panier

Voir la fiche descriptive
Page précédente  1, 2, 3 ... 66, 67, 68 ... 142, 143, 144  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion