Lustiner
Panier d'achat
Votre panier est vide
Modifier ma recherche

:

:

:

:

1, 2, 3 ... 56, 57, 58  Page suivante

(±)-acide jasmonique (plant cell culture tested liquid)

 Note: This product is a clear, colorless to very light yellow oil that adheres to the surface of the vial.

(±)-acide jasmonique (plant cell culture tested, liquid)
(±)-1a,2Beta-3-Oxo-2-(cis-2-pentenyl)cyclopentaneacetic acid

100 mg

211.59 €HT

 

(±)-acide jasmonique (plant cell culture tested, liquid)
(±)-1a,2Beta-3-Oxo-2-(cis-2-pentenyl)cyclopentaneacetic acid

250 mg

466.36 €HT

 

2,3,5-Triphényl-tétrazolium chlorure (solution) - TTC - BioChemika, pour microbiologie

2,3,5-Triphenyl-tetrazolium chloride solution (TTC solution)

Référence : 3835841

Unité de vente : 10 x 10 ml

2-Mercaptoéthanol

Propriétés :
Vapor density : 2.69 (vs air)
Vapor pressure : 1 mmHg (20 °C)
Expl. lim.: 18 %
Concentration : 14.3 M (pure liquid)
Refractive index :
  n20/D = 1.500 (lit.)
  n20/D = 1.501
bp = 157°C (lit.)
Density : 1.115 g/mL at 20°C ; 1.114 g/mL at 25°C (lit.).

Suitability : suitable for cell culture  
Foreign activity : DNase, RNase, protease, none detected

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

1 litre

219.09 €HT

 

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

10 ml

45.27 €HT

 

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

100 ml

52.91 €HT

 

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

2,5 litres

430.00 €HT

 

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

250 ml

85.27 €HT

 

2-Mercaptoéthanol 99,0 %+
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

500 ml

126.18 €HT

 

2-Mercaptoéthanol 99,0 %+ (pour biologie moléculaire, électrophorèse, culture cellulaire)
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

100 ml

51.55 €HT

 

2-Mercaptoéthanol 99,0 %+ (pour biologie moléculaire, électrophorèse, culture cellulaire)
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

25 ml

21.80 €HT

 

2-Mercaptoéthanol 99,0 %+ (pour biologie moléculaire, électrophorèse, culture cellulaire)
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

250 ml

118.05 €HT

 

2-Mercaptoéthanol 99,0 %+ (pour biologie moléculaire, électrophorèse, culture cellulaire)
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

500 ml

176.59 €HT

 

2-Mercaptoéthanol BioReagent 99 % p/biologie moléculaire,électrophorèse,culture cellulaire
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

100 ml

49.80 €HT

 

2-Mercaptoéthanol BioReagent 99 % p/biologie moléculaire,électrophorèse,culture cellulaire
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

25 ml

21.00 €HT

 

2-Mercaptoéthanol BioReagent 99 % p/biologie moléculaire,électrophorèse,culture cellulaire
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

250 ml

114.07 €HT

 

2-Mercaptoéthanol BioReagent 99 % p/biologie moléculaire,électrophorèse,culture cellulaire
Beta-Mercaptoethanol, 2-Hydroxyethylmercaptan, BME, Thioethylene glycol

500 ml

170.23 €HT

 

5-Lipoxygenase (potato) - Monomère 98 %+

En solution dans 0,1 M tampon phosphate, pH 6.3, contenant 2 M ammonium sulfate

Référence : 5927650

Unité de vente : 1 kU

A.D.N. (gélose) / DNase test Agar

Péremption : 12 mois à fabrication. Certificat d'analyses inclus

Référence : 8715651

Unité de vente : 10 x 100 ml

A.D.N. (gélose) / DNase test Agar

Deoxyribonuclease Test Agar, for microbiology

Référence : 8827831

Unité de vente : 500 g

ACAGCAGACGCACACAAACC (Reverse primer 5'-3')

AF268391 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 9641701

Unité de vente : Tube

ACAGCAGCAACAATCTCGTCGT (Reverse primer 5'-3')

DN240063 R. Nombre de bases : 22. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 3501370

Unité de vente : Tube

Acétate solution tampon - pH=4,65 (à 20°C)

Acetic acid-Sodium acetate buffer 1:1 pH 4.65

Référence : 9642487

Unité de vente : 1 litre

ACGCAGCACAAGTCGTCCA (Reverse primer 5'-3')

Ma513035997 R. Nombre de bases : 19. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 5195326

Unité de vente : Tube

ACGGAAAACCACAAGCAATC (Reverse primer 5'-3')

MABN26 R. Nombre de bases : 20. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 1139297

Unité de vente : Tube

ACGGAGCAGTAACACGGGATTG (Reverse primer 5'-3')

Ma513019043 R. Nombre de bases : 22. Echelle de synthèse : 0,0500 µMO. Désalée.

Référence : 4922613

Unité de vente : Tube

1, 2, 3 ... 56, 57, 58  Page suivante
Portail collaboratif Réalisé par Ovidentia, Ovidentia est une marque déposée par Cantico. Gestion